Write a Python script that translates two genes in an RNA sequence into
their protein sequence and prints them. Each gene begins with an AUG from
the left and ends in UAG and has a length that is a multiple of three.
However, the RNA sequence length may not be a multiple of three and there
may be more than one "UAG" or "AUG" in the sequence.

For example if the input is

>human
ACAUGCUAGAAUAGCCGCAUGUACUAGUUAA

then the output should be

MLE
MY

even though there are three UAG's. 

Submit a hardcopy in class on Oct 14th.